Genetic and phenotypic landscape of the mitochondrial genome in the Japanese population.

The genetic landscape of mitochondrial DNA (mtDNA) has been elusive. By analyzing mtDNA using the whole genome sequence (WGS) of Japanese individuals (n = 1928), we identified 2023 mtDNA variants and high-resolution haplogroups.

Frequency spectra of the haplogroups were population-specific and were heterogeneous among geographic regions within Japan. Application of machine learning methods could finely classify the subjects corresponding to the high-digit mtDNA sub-haplogroups.

HCFC1 Antibody
33797-100ul	SAB	100ul	EUR 252

HCFC1 Antibody
33797-50ul	SAB	50ul	EUR 187

HCFC1 antibody
38309-100ul	SAB	100ul	EUR 252

HCFC1 Antibody
CSB-PA914205-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

HCFC1 Antibody
CSB-PA914205-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

HCFC1 Antibody
DF6651	Affbiotech	200ul	EUR 304
Description: HCFC1 Antibody detects endogenous levels of total HCFC1.

HCFC1 antibody
70R-51556	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal HCFC1 antibody

HCFC1 Antibody
1-CSB-PA009124	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

HCFC1 Antibody
1-CSB-PA010166GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

HCFC1 Antibody
1-CSB-PA010166LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

HCFC1 siRNA
20-abx919147	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HCFC1 siRNA
20-abx919148	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HCFC1 Antibody
ABD6651	Lifescience Market	100 ug	EUR 438

HCFC1 Blocking Peptide
DF6651-BP	Affbiotech	1mg	EUR 195

HCFC1 Blocking Peptide
20-abx062131	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

HCFC1 Conjugated Antibody
C33797	SAB	100ul	EUR 397

HCFC1 cloning plasmid
CSB-CL010166HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1287 Sequence: atggcttcggccgtgtcgcccgccaacttgccagcggtgcttctgcagccccgctggaagcgagtggtgggctggtcgggtccggtgccacggccccgccacggccaccgcgccgtggccatcaaggagctcatcgtggtgtttggcggcggcaacgagggaatagtggacgaac Show more
Description: A cloning plasmid for the HCFC1 gene.

HCFC1 Rabbit pAb
A1841-100ul	Abclonal	100 ul	EUR 308

HCFC1 Rabbit pAb
A1841-200ul	Abclonal	200 ul	EUR 459

HCFC1 Rabbit pAb
A1841-20ul	Abclonal	20 ul	EUR 183

HCFC1 Rabbit pAb
A1841-50ul	Abclonal	50 ul	EUR 223

HCFC1 Rabbit pAb
A16871-100ul	Abclonal	100 ul	EUR 308

HCFC1 Rabbit pAb
A16871-200ul	Abclonal	200 ul	EUR 459

HCFC1 Rabbit pAb
A16871-20ul	Abclonal	20 ul	EUR 183

HCFC1 Rabbit pAb
A16871-50ul	Abclonal	50 ul	EUR 223

anti- HCFC1 antibody
FNab03782	FN Test	100µg	EUR 548.75
Immunogen: host cell factor C1(VP16-accessory protein) Uniprot ID: P51610 Gene ID: 3054 Research Area: Metabolism
Description: Antibody raised against HCFC1

Anti-HCFC1 antibody
PAab03782	Lifescience Market	100 ug	EUR 386

Anti-HCFC1 antibody
STJ119231	St John's Laboratory	100 µl	EUR 277

Anti-HCFC1 antibody
STJ23922	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the host cell factor family and encodes a protein with five Kelch repeats, a fibronectin-like motif, and six HCF repeats, each of which contains a highly specific cleavage signal. This nuclear coactivator is proteolytically cleaved at one of the six possible sites, resulting in the creation of an N-terminal chain and the corresponding C-terminal chain. The final form of this protein consists of noncovalently bound N- and C-terminal chains. The protein is involved in control of the cell cycle and transcriptional regulation during herpes simplex virus infection. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized.

Anti-HCFC1/Hcf1 Antibody
A01729	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal HCFC1/Hcf1 Antibody. Validated in IHC and tested in Human, Mouse.

HCFC1 ELISA KIT|Human
EF010072	Lifescience Market	96 Tests	EUR 689

HCFC1 Antibody, HRP conjugated
1-CSB-PA010166LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HCFC1 Antibody, FITC conjugated
1-CSB-PA010166LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HCFC1 Antibody, Biotin conjugated
1-CSB-PA010166LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human HCFC1 shRNA Plasmid
20-abx952079	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse HCFC1 shRNA Plasmid
20-abx970761	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Hcfc1 ORF Vector (Rat) (pORF)
ORF068096	ABM	1.0 ug DNA	EUR 2218

HCFC1 ORF Vector (Human) (pORF)
ORF004823	ABM	1.0 ug DNA	EUR 95

Hcfc1 ORF Vector (Mouse) (pORF)
ORF047017	ABM	1.0 ug DNA	EUR 2230

Host Cell Factor 1 (HCFC1) Antibody
20-abx007502	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Host Cell Factor C1 (HCFC1) Antibody
20-abx113061	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Host Cell Factor C1 (HCFC1) Antibody
20-abx131136	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Host Cell Factor C1 (HCFC1) Antibody
20-abx131137	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Host Cell Factor 1 (HCFC1) Antibody
20-abx013517	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Polyclonal HCF1 / HCFC1 Antibody (aa131-180)
APR11112G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCF1 / HCFC1 (aa131-180). This antibody is tested and proven to work in the following applications:

Host Cell Factor 1 (HCFC1) Antibody
abx233782-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Host Cell Factor C1 (HCFC1) Antibody
abx331400-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Host Cell Factor C1 (HCFC1) Antibody
20-abx325216	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Host Cell Factor 1 (HCFC1) Antibody
20-abx302096	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Host Cell Factor 1 (HCFC1) Antibody
20-abx001521	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Hcfc1 sgRNA CRISPR Lentivector set (Rat)
K6397501	ABM	3 x 1.0 ug	EUR 339

Hcfc1 sgRNA CRISPR Lentivector set (Mouse)
K3836901	ABM	3 x 1.0 ug	EUR 339

HCFC1 sgRNA CRISPR Lentivector set (Human)
K0933101	ABM	3 x 1.0 ug	EUR 339

HCFC1-AS1 ORF Vector (Human) (pORF)
ORF020594	ABM	1.0 ug DNA	Ask for price

Recombinant Host Cell Factor C1 (HCFC1)
4-RPC209Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51610 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Host Cell Factor C1 expressed in: E.coli

Recombinant Host Cell Factor C1 (HCFC1)
4-RPC209Mu01	Cloud-Clone	EUR 431.52 EUR 218.00 EUR 1343.20 EUR 514.40 EUR 928.80 EUR 352.00 EUR 3208.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q61191 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Host Cell Factor C1 expressed in: E.coli

Human Host Cell Factor C1 (HCFC1) Protein
20-abx168841	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Host Cell Factor C1 (HCFC1) Protein
20-abx168842	Abbexa	EUR 606.00 EUR 258.00 EUR 1817.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Host Cell Factor 1 (HCFC1) Antibody (HRP)
20-abx314161	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Host Cell Factor 1 (HCFC1) Antibody (FITC)
20-abx314162	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Host Cell Factor 1 (HCFC1) Antibody (Biotin)
20-abx314163	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hcfc1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6397502	ABM	1.0 ug DNA	EUR 154

Hcfc1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6397503	ABM	1.0 ug DNA	EUR 154

Hcfc1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6397504	ABM	1.0 ug DNA	EUR 154

Hcfc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3836902	ABM	1.0 ug DNA	EUR 154

Hcfc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3836903	ABM	1.0 ug DNA	EUR 154

Hcfc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3836904	ABM	1.0 ug DNA	EUR 154

HCFC1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0933102	ABM	1.0 ug DNA	EUR 154

HCFC1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0933103	ABM	1.0 ug DNA	EUR 154

HCFC1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0933104	ABM	1.0 ug DNA	EUR 154

HCFC1 Protein Vector (Rat) (pPB-C-His)
PV272382	ABM	500 ng	EUR 3351

HCFC1 Protein Vector (Rat) (pPB-N-His)
PV272383	ABM	500 ng	EUR 3351

HCFC1 Protein Vector (Rat) (pPM-C-HA)
PV272384	ABM	500 ng	EUR 3351

HCFC1 Protein Vector (Rat) (pPM-C-His)
PV272385	ABM	500 ng	EUR 3351

HCFC1 Protein Vector (Mouse) (pPB-C-His)
PV188066	ABM	500 ng	EUR 3368

HCFC1 Protein Vector (Mouse) (pPB-N-His)
PV188067	ABM	500 ng	EUR 3368

HCFC1 Protein Vector (Mouse) (pPM-C-HA)
PV188068	ABM	500 ng	EUR 3368

HCFC1 Protein Vector (Mouse) (pPM-C-His)
PV188069	ABM	500 ng	EUR 3368

HCFC1 Protein Vector (Human) (pPB-C-His)
PV019289	ABM	500 ng	EUR 329

HCFC1 Protein Vector (Human) (pPB-N-His)
PV019290	ABM	500 ng	EUR 329

HCFC1 Protein Vector (Human) (pPM-C-HA)
PV019291	ABM	500 ng	EUR 329

HCFC1 Protein Vector (Human) (pPM-C-His)
PV019292	ABM	500 ng	EUR 329

Hcfc1 3'UTR Luciferase Stable Cell Line
TU109390	ABM	1.0 ml	Ask for price

Hcfc1 3'UTR Luciferase Stable Cell Line
TU205667	ABM	1.0 ml	Ask for price

Hcfc1 3'UTR GFP Stable Cell Line
TU159390	ABM	1.0 ml	Ask for price

Hcfc1 3'UTR GFP Stable Cell Line
TU255667	ABM	1.0 ml	Ask for price

HCFC1 3'UTR GFP Stable Cell Line
TU059595	ABM	1.0 ml	EUR 1521

HCFC1 3'UTR Luciferase Stable Cell Line
TU009595	ABM	1.0 ml	EUR 1521

Human Host cell factor 1, HCFC1 ELISA KIT
ELI-19347h	Lifescience Market	96 Tests	EUR 824

Human Host Cell Factor 1 (HCFC1) ELISA Kit
abx387747-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Host Cell Factor 1 (HCFC1) ELISA Kit
abx389567-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Host cell factor 1, Hcfc1 ELISA KIT
ELI-38900m	Lifescience Market	96 Tests	EUR 865

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse)
4-PAC209Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Ser107-Thr332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1)

HCFC1-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV727343	ABM	1.0 ug DNA	Ask for price

HCFC1-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV727347	ABM	1.0 ug DNA	Ask for price

HCFC1-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV727348	ABM	1.0 ug DNA	Ask for price

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse)
4-PAC209Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Asn52~His258) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1)

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), APC
4-PAC209Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Ser107-Thr332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with APC.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC209Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Ser107-Thr332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with Biotin.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), Cy3
4-PAC209Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Ser107-Thr332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with Cy3.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), FITC
4-PAC209Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Ser107-Thr332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with FITC.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), HRP
4-PAC209Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Ser107-Thr332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with HRP.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), PE
4-PAC209Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Ser107-Thr332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with PE.

Hcfc1 ELISA Kit| Mouse Host cell factor 1 ELISA Kit
EF015201	Lifescience Market	96 Tests	EUR 689

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6397505	ABM	3 x 1.0 ug	EUR 376

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3836905	ABM	3 x 1.0 ug	EUR 376

HCFC1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0933105	ABM	3 x 1.0 ug	EUR 376

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), APC
4-PAC209Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Asn52~His258) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with APC.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC209Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Asn52~His258) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with Biotin.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC209Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Asn52~His258) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with Cy3.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), FITC
4-PAC209Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Asn52~His258) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with FITC.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), HRP
4-PAC209Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Asn52~His258) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with HRP.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), PE
4-PAC209Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Asn52~His258) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with PE.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC209Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Ser107-Thr332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with APC-Cy7.

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6397506	ABM	1.0 ug DNA	EUR 167

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6397507	ABM	1.0 ug DNA	EUR 167

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6397508	ABM	1.0 ug DNA	EUR 167

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3836906	ABM	1.0 ug DNA	EUR 167

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3836907	ABM	1.0 ug DNA	EUR 167

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3836908	ABM	1.0 ug DNA	EUR 167

HCFC1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0933106	ABM	1.0 ug DNA	EUR 167

HCFC1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0933107	ABM	1.0 ug DNA	EUR 167

HCFC1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0933108	ABM	1.0 ug DNA	EUR 167

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC209Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCFC1 (Asn52~His258) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with APC-Cy7.

HCFC1-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV727344	ABM	1.0 ug DNA	Ask for price

HCFC1-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV727345	ABM	1.0 ug DNA	Ask for price

HCFC1-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV727346	ABM	1.0 ug DNA	Ask for price

mtDNA had distinct genetic structures from that of nuclear DNA (nDNA), characterized by no distance-dependent linkage disequilibrium decay, sparse tagging of common variants, and the existence of common haplotypes spanning the entire mtDNA.

We did not detect any evidence of mtDNA-nDNA (or mtDNA copy number-nDNA) genotype associations. Together with WGS-based mtDNA variant imputation, we conducted a phenome-wide association study of 147,437 Japanese individuals with 99 clinical phenotypes.