Genetic and phenotypic landscape of the mitochondrial genome in the Japanese population.

The genetic landscape of mitochondrial DNA (mtDNA) has been elusive. By analyzing mtDNA using the whole genome sequence (WGS) of Japanese individuals (n = 1928), we identified 2023 mtDNA variants and high-resolution haplogroups.

Frequency spectra of the haplogroups were population-specific and were heterogeneous among geographic regions within Japan. Application of machine learning methods could finely classify the subjects corresponding to the high-digit mtDNA sub-haplogroups.

HCFC1 antibody

70R-51556 100 ul
EUR 244.00
Description: Purified Polyclonal HCFC1 antibody

HCFC1 antibody

70R-31750 100 ug
EUR 327.00
Description: Rabbit polyclonal HCFC1 antibody

HCFC1 Antibody

ABD6651 100 ug
EUR 438.00

HCFC1 antibody

38309-100ul 100ul
EUR 252.00

HCFC1 Antibody

33797-100ul 100ul
EUR 252.00

HCFC1 Antibody

33797-50ul 50ul
EUR 187.00

HCFC1 antibody

70R-17698 50 ul
EUR 435.00
Description: Rabbit polyclonal HCFC1 antibody

HCFC1 Antibody

DF6651 200ul
EUR 304.00
Description: HCFC1 Antibody detects endogenous levels of total HCFC1.

HCFC1 Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

HCFC1 Antibody

CSB-PA914205-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

HCFC1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

HCFC1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

HCFC1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

HCFC1 Conjugated Antibody

C33797 100ul
EUR 397.00

HCFC1 cloning plasmid

CSB-CL010166HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1287
  • Sequence: atggcttcggccgtgtcgcccgccaacttgccagcggtgcttctgcagccccgctggaagcgagtggtgggctggtcgggtccggtgccacggccccgccacggccaccgcgccgtggccatcaaggagctcatcgtggtgtttggcggcggcaacgagggaatagtggacgaac
  • Show more
Description: A cloning plasmid for the HCFC1 gene.

anti- HCFC1 antibody

FNab03782 100µg
EUR 548.75
  • Immunogen: host cell factor C1(VP16-accessory protein)
  • Uniprot ID: P51610
  • Gene ID: 3054
  • Research Area: Metabolism
Description: Antibody raised against HCFC1

HCFC1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HCFC1 Rabbit pAb

A1841-100ul 100 ul
EUR 308.00

HCFC1 Rabbit pAb

A1841-200ul 200 ul
EUR 459.00

HCFC1 Rabbit pAb

A1841-20ul 20 ul
EUR 183.00

HCFC1 Rabbit pAb

A1841-50ul 50 ul
EUR 223.00

HCFC1 Rabbit pAb

A16871-100ul 100 ul
EUR 308.00

HCFC1 Rabbit pAb

A16871-200ul 200 ul
EUR 459.00

HCFC1 Rabbit pAb

A16871-20ul 20 ul
EUR 183.00

HCFC1 Rabbit pAb

A16871-50ul 50 ul
EUR 223.00

HCFC1 Blocking Peptide

DF6651-BP 1mg
EUR 195.00

Anti-HCFC1 antibody

PAab03782 100 ug
EUR 386.00

Anti-HCFC1 antibody

STJ23922 100 µl
EUR 277.00
Description: This gene is a member of the host cell factor family and encodes a protein with five Kelch repeats, a fibronectin-like motif, and six HCF repeats, each of which contains a highly specific cleavage signal. This nuclear coactivator is proteolytically cleaved at one of the six possible sites, resulting in the creation of an N-terminal chain and the corresponding C-terminal chain. The final form of this protein consists of noncovalently bound N- and C-terminal chains. The protein is involved in control of the cell cycle and transcriptional regulation during herpes simplex virus infection. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized.

Anti-HCFC1 antibody

STJ119231 100 µl
EUR 277.00


EF010072 96 Tests
EUR 689.00

Anti-HCFC1/Hcf1 Antibody

A01729 100ul
EUR 397.00
Description: Rabbit Polyclonal HCFC1/Hcf1 Antibody. Validated in IHC and tested in Human, Mouse.

Mouse HCFC1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human HCFC1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

HCFC1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HCFC1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HCFC1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HCFC1. Recognizes HCFC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HCFC1 ORF Vector (Human) (pORF)

ORF004823 1.0 ug DNA
EUR 95.00

Hcfc1 ORF Vector (Rat) (pORF)

ORF068096 1.0 ug DNA
EUR 2218.00

Hcfc1 ORF Vector (Mouse) (pORF)

ORF047017 1.0 ug DNA
EUR 2230.00

Polyclonal HCF1 / HCFC1 Antibody (aa131-180)

APR11112G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCF1 / HCFC1 (aa131-180). This antibody is tested and proven to work in the following applications:

HCFC1 sgRNA CRISPR Lentivector set (Human)

K0933101 3 x 1.0 ug
EUR 339.00

Host Cell Factor C1 (HCFC1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Host Cell Factor C1 (HCFC1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Host Cell Factor C1 (HCFC1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Host Cell Factor 1 (HCFC1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Host Cell Factor 1 (HCFC1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Host Cell Factor 1 (HCFC1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Host Cell Factor C1 (HCFC1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Host Cell Factor C1 (HCFC1) Antibody

abx331400-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Host Cell Factor 1 (HCFC1) Antibody

abx233782-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Host Cell Factor 1 (HCFC1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Hcfc1 sgRNA CRISPR Lentivector set (Mouse)

K3836901 3 x 1.0 ug
EUR 339.00

Hcfc1 sgRNA CRISPR Lentivector set (Rat)

K6397501 3 x 1.0 ug
EUR 339.00

HCFC1-AS1 ORF Vector (Human) (pORF)

ORF020594 1.0 ug DNA Ask for price

Recombinant Host Cell Factor C1 (HCFC1)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P51610
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Host Cell Factor C1 expressed in: E.coli

Recombinant Host Cell Factor C1 (HCFC1)

  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • EUR 514.40
  • EUR 928.80
  • EUR 352.00
  • EUR 3208.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q61191
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Host Cell Factor C1 expressed in: E.coli

HCFC1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0933102 1.0 ug DNA
EUR 154.00

HCFC1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0933103 1.0 ug DNA
EUR 154.00

HCFC1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0933104 1.0 ug DNA
EUR 154.00

Human Host Cell Factor C1 (HCFC1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Mouse Host Cell Factor C1 (HCFC1) Protein

  • EUR 606.00
  • EUR 258.00
  • EUR 1817.00
  • EUR 718.00
  • EUR 439.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Host Cell Factor 1 (HCFC1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Host Cell Factor 1 (HCFC1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Host Cell Factor 1 (HCFC1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Hcfc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3836902 1.0 ug DNA
EUR 154.00

Hcfc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3836903 1.0 ug DNA
EUR 154.00

Hcfc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3836904 1.0 ug DNA
EUR 154.00

Hcfc1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6397502 1.0 ug DNA
EUR 154.00

Hcfc1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6397503 1.0 ug DNA
EUR 154.00

Hcfc1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6397504 1.0 ug DNA
EUR 154.00

HCFC1 Protein Vector (Rat) (pPB-C-His)

PV272382 500 ng
EUR 3351.00

HCFC1 Protein Vector (Rat) (pPB-N-His)

PV272383 500 ng
EUR 3351.00

HCFC1 Protein Vector (Rat) (pPM-C-HA)

PV272384 500 ng
EUR 3351.00

HCFC1 Protein Vector (Rat) (pPM-C-His)

PV272385 500 ng
EUR 3351.00

HCFC1 Protein Vector (Human) (pPB-C-His)

PV019289 500 ng
EUR 329.00

HCFC1 Protein Vector (Human) (pPB-N-His)

PV019290 500 ng
EUR 329.00

HCFC1 Protein Vector (Human) (pPM-C-HA)

PV019291 500 ng
EUR 329.00

HCFC1 Protein Vector (Human) (pPM-C-His)

PV019292 500 ng
EUR 329.00

HCFC1 Protein Vector (Mouse) (pPB-C-His)

PV188066 500 ng
EUR 3368.00

HCFC1 Protein Vector (Mouse) (pPB-N-His)

PV188067 500 ng
EUR 3368.00

HCFC1 Protein Vector (Mouse) (pPM-C-HA)

PV188068 500 ng
EUR 3368.00

HCFC1 Protein Vector (Mouse) (pPM-C-His)

PV188069 500 ng
EUR 3368.00

Hcfc1 3'UTR Luciferase Stable Cell Line

TU205667 1.0 ml Ask for price

Hcfc1 3'UTR GFP Stable Cell Line

TU159390 1.0 ml Ask for price

HCFC1 3'UTR Luciferase Stable Cell Line

TU009595 1.0 ml
EUR 1521.00

Hcfc1 3'UTR Luciferase Stable Cell Line

TU109390 1.0 ml Ask for price

HCFC1 3'UTR GFP Stable Cell Line

TU059595 1.0 ml
EUR 1521.00

Hcfc1 3'UTR GFP Stable Cell Line

TU255667 1.0 ml Ask for price

Human Host cell factor 1, HCFC1 ELISA KIT

ELI-19347h 96 Tests
EUR 824.00

Mouse Host cell factor 1, Hcfc1 ELISA KIT

ELI-38900m 96 Tests
EUR 865.00

Human Host Cell Factor 1 (HCFC1) ELISA Kit

abx387747-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse Host Cell Factor 1 (HCFC1) ELISA Kit

abx389567-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Ser107-Thr332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1)

HCFC1-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV727343 1.0 ug DNA Ask for price

HCFC1-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV727347 1.0 ug DNA Ask for price

HCFC1-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV727348 1.0 ug DNA Ask for price

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Asn52~His258)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1)

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Ser107-Thr332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with APC.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Ser107-Thr332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with Biotin.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Ser107-Thr332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with Cy3.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Ser107-Thr332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with FITC.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Ser107-Thr332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with HRP.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Ser107-Thr332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with PE.

Hcfc1 ELISA Kit| Mouse Host cell factor 1 ELISA Kit

EF015201 96 Tests
EUR 689.00

HCFC1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0933105 3 x 1.0 ug
EUR 376.00

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3836905 3 x 1.0 ug
EUR 376.00

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6397505 3 x 1.0 ug
EUR 376.00

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Asn52~His258)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with APC.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Asn52~His258)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with Biotin.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Asn52~His258)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with Cy3.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Asn52~His258)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with FITC.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Asn52~His258)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with HRP.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Asn52~His258)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with PE.

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Ser107-Thr332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with APC-Cy7.

HCFC1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0933106 1.0 ug DNA
EUR 167.00

HCFC1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0933107 1.0 ug DNA
EUR 167.00

HCFC1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0933108 1.0 ug DNA
EUR 167.00

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3836906 1.0 ug DNA
EUR 167.00

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3836907 1.0 ug DNA
EUR 167.00

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3836908 1.0 ug DNA
EUR 167.00

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6397506 1.0 ug DNA
EUR 167.00

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6397507 1.0 ug DNA
EUR 167.00

Hcfc1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6397508 1.0 ug DNA
EUR 167.00

Host Cell Factor C1 (HCFC1) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: HCFC1 (Asn52~His258)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Host Cell Factor C1 (HCFC1). This antibody is labeled with APC-Cy7.

HCFC1-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV727344 1.0 ug DNA Ask for price

HCFC1-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV727345 1.0 ug DNA Ask for price

HCFC1-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV727346 1.0 ug DNA Ask for price

mtDNA had distinct genetic structures from that of nuclear DNA (nDNA), characterized by no distance-dependent linkage disequilibrium decay, sparse tagging of common variants, and the existence of common haplotypes spanning the entire mtDNA.

We did not detect any evidence of mtDNA-nDNA (or mtDNA copy number-nDNA) genotype associations. Together with WGS-based mtDNA variant imputation, we conducted a phenome-wide association study of 147,437 Japanese individuals with 99 clinical phenotypes.
