The organism Caenorhabditis elegans is a performant model system for studying human biological processes and diseases, but until now all phenome data are produced as population-averaged read-outs.
Monitoring of individual responses to drug treatments would however be more informative. Here, a new strategy to track different phenotypic traits of individual C. elegans nematodes throughout their full life-cycle-i.e., embryonic and post-embryonic development, until adulthood onset, differently from life-span-is presented.
Human Histone Deacetylase 3 (HDAC3) ELISA kit |
RDR-HDAC3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544.00 |
Human Histone Deacetylase 3 (HDAC3) ELISA kit |
RDR-HDAC3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756.00 |
HDAC3 antibody |
20R-2774 |
Fitzgerald |
50 ug |
EUR 281.00 |
Description: Rabbit polyclonal HDAC3 antibody |
HDAC3 Antibody |
21660-100ul |
SAB |
100ul |
EUR 252.00 |
HDAC3 Antibody |
21660-50ul |
SAB |
50ul |
EUR 187.00 |
HDAC3 Antibody |
31216-100ul |
SAB |
100ul |
EUR 252.00 |
HDAC3 Antibody |
31216-50ul |
SAB |
50ul |
EUR 187.00 |
HDAC3 antibody |
70R-17706 |
Fitzgerald |
50 ul |
EUR 435.00 |
Description: Rabbit polyclonal HDAC3 antibody |
HDAC3 antibody |
70R-11943 |
Fitzgerald |
100 ug |
EUR 403.00 |
Description: Rabbit polyclonal HDAC3 antibody |
HDAC3 antibody |
70R-31225 |
Fitzgerald |
100 ug |
EUR 327.00 |
Description: Rabbit polyclonal HDAC3 antibody |
HDAC3 antibody |
70R-14137 |
Fitzgerald |
100 ug |
EUR 322.00 |
Description: Affinity purified Rabbit polyclonal HDAC3 antibody |
HDAC3 Antibody |
33400-100ul |
SAB |
100ul |
EUR 252.00 |
HDAC3 Antibody |
33400-50ul |
SAB |
50ul |
EUR 187.00 |
HDAC3 Antibody |
32620-100ul |
SAB |
100ul |
EUR 252.00 |
HDAC3 antibody |
10R-2003 |
Fitzgerald |
100 ul |
EUR 435.00 |
Description: Mouse monoclonal HDAC3 antibody |
HDAC3 antibody |
10R-2004 |
Fitzgerald |
100 ul |
EUR 435.00 |
Description: Mouse monoclonal HDAC3 antibody |
HDAC3 antibody |
10R-10389 |
Fitzgerald |
100 ug |
EUR 435.00 |
Description: Mouse monoclonal HDAC3 antibody |
HDAC3 Antibody |
48964-100ul |
SAB |
100ul |
EUR 333.00 |
HDAC3 Antibody |
48964-50ul |
SAB |
50ul |
EUR 239.00 |
HDAC3 Antibody |
1-CSB-PA002880 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000 |
HDAC3 Antibody |
1-CSB-PA004117 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
HDAC3 Antibody |
CSB-PA916163- |
Cusabio |
|
EUR 335.00 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
HDAC3 Antibody |
CSB-PA916163-100ul |
Cusabio |
100ul |
EUR 316.00 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
HDAC3 Antibody |
CSB-PA967736- |
Cusabio |
|
EUR 335.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
HDAC3 Antibody |
CSB-PA967736-100ul |
Cusabio |
100ul |
EUR 316.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
HDAC3 Antibody |
1-CSB-PA899967 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
HDAC3 Antibody |
DF6862 |
Affbiotech |
200ul |
EUR 304.00 |
Description: HDAC3 Antibody detects endogenous levels of total HDAC3. |
Hdac3 antibody |
70R-8546 |
Fitzgerald |
50 ug |
EUR 467.00 |
Description: Affinity purified rabbit polyclonal Hdac3 antibody |
HDAC3 antibody |
70R-33611 |
Fitzgerald |
100 ug |
EUR 327.00 |
Description: Rabbit polyclonal HDAC3 antibody |
HDAC3 Protein |
E24006 |
EpiGentek |
50 µg |
EUR 806.90 |
Description: fast delivery possible |
HDAC3 Antibody |
AF0733 |
Affbiotech |
200ul |
EUR 304.00 |
Description: HDAC3 Antibody detects endogenous levels of HDAC3. |
HDAC3 Antibody |
AF5349 |
Affbiotech |
200ul |
EUR 304.00 |
Description: HDAC3 Antibody detects endogenous levels of total HDAC3. |
HDAC3 Antibody |
AF6016 |
Affbiotech |
200ul |
EUR 304.00 |
Description: HDAC3 Antibody detects endogenous levels of total HDAC3. |
HDAC3 Antibody |
BF0230 |
Affbiotech |
200ul |
EUR 376.00 |
Description: HDAC3 antibody detects endogenous levels of total HDAC3. |
HDAC3 Antibody |
1-CSB-PA010239GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
HDAC3 Antibody |
1-CSB-PA010239LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
HDAC3 siRNA |
20-abx919179 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HDAC3 siRNA |
20-abx919180 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-HDAC3 |
YF-PA15910 |
Abfrontier |
50 ul |
EUR 363.00 |
Description: Mouse polyclonal to HDAC3 |
anti-HDAC3 |
YF-PA15911 |
Abfrontier |
100 ul |
EUR 403.00 |
Description: Rabbit polyclonal to HDAC3 |
anti-HDAC3 |
YF-PA15912 |
Abfrontier |
100 ug |
EUR 403.00 |
Description: Rabbit polyclonal to HDAC3 |
anti-HDAC3 |
YF-PA25204 |
Abfrontier |
50 ul |
EUR 334.00 |
Description: Mouse polyclonal to HDAC3 |
anti-HDAC3 |
YF-PA25205 |
Abfrontier |
50 ul |
EUR 334.00 |
Description: Mouse polyclonal to HDAC3 |
HDAC3 Monoclonal Antibody |
27125-100ul |
SAB |
100ul |
EUR 252.00 |
HDAC3 Monoclonal Antibody |
27125-50ul |
SAB |
50ul |
EUR 187.00 |
HDAC3 Rabbit pAb |
A12542-100ul |
Abclonal |
100 ul |
EUR 308.00 |
HDAC3 Rabbit pAb |
A12542-200ul |
Abclonal |
200 ul |
EUR 459.00 |
HDAC3 Rabbit pAb |
A12542-20ul |
Abclonal |
20 ul |
EUR 183.00 |
HDAC3 Rabbit pAb |
A12542-50ul |
Abclonal |
50 ul |
EUR 223.00 |
Hdac3 Blocking Peptide |
33R-2222 |
Fitzgerald |
100 ug |
EUR 180.00 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hdac3 antibody, catalog no. 70R-8546 |
HDAC3 Blocking Peptide |
33R-10828 |
Fitzgerald |
50 ug |
EUR 191.00 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HDAC3 antibody, catalog no. 70R-11943 |
HDAC3 Polyclonal Antibody |
40996-100ul |
SAB |
100ul |
EUR 252.00 |
HDAC3 Polyclonal Antibody |
40996-50ul |
SAB |
50ul |
EUR 187.00 |
HDAC3 Assay Kit |
55R-1377 |
Fitzgerald |
100 assays |
EUR 693.00 |
Description: Assay Kit for detection of HDAC3 in the research laboratory |
HDAC3 Blocking Peptide |
DF6862-BP |
Affbiotech |
1mg |
EUR 195.00 |
Anti-HDAC3 Antibody |
A00839 |
BosterBio |
100ug/vial |
EUR 294.00 |
HDAC3 antibody (Ser424) |
70R-33610 |
Fitzgerald |
100 ug |
EUR 327.00 |
Description: Rabbit polyclonal HDAC3 antibody (Ser424) |
HDAC3 (pS424) Antibody |
abx010928-100ug |
Abbexa |
100 ug |
EUR 439.00 |
- Shipped within 5-10 working days.
|
HDAC3 Blocking Peptide |
AF0733-BP |
Affbiotech |
1mg |
EUR 195.00 |
HDAC3 Blocking Peptide |
AF5349-BP |
Affbiotech |
1mg |
EUR 195.00 |
HDAC3 Blocking Peptide |
AF6016-BP |
Affbiotech |
1mg |
EUR 195.00 |
HDAC3 Conjugated Antibody |
C32620 |
SAB |
100ul |
EUR 397.00 |
HDAC3 Conjugated Antibody |
C31216 |
SAB |
100ul |
EUR 397.00 |
HDAC3 Blocking Peptide |
BF0230-BP |
Affbiotech |
1mg |
EUR 195.00 |
HDAC3-specific Antibody |
abx233799-100ug |
Abbexa |
100 ug |
EUR 509.00 |
- Shipped within 5-12 working days.
|
HDAC3 (pS424) Antibody |
abx333379-100ul |
Abbexa |
100 ul |
EUR 467.00 |
- Shipped within 5-10 working days.
|
Polyclonal HDAC3 Antibody |
AMM05315G |
Leading Biology |
0.1mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications: |
Polyclonal HDAC3 Antibody |
AMM05316G |
Leading Biology |
0.1mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications: |
Monoclonal HDAC3 Antibody |
AMM05317G |
Leading Biology |
0.1ml |
EUR 484.00 |
Description: A Monoclonal antibody against Human HDAC3. The antibodies are raised in Mouse. This antibody is applicable in WB |
HDAC3 cloning plasmid |
CSB-CL010239HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1287
- Sequence: atggccaagaccgtggcctatttctacgaccccgacgtgggcaacttccactacggagctggacaccctatgaagccccatcgcctggcattgacccatagcctggtcctgcattacggtctctataagaagatgatcgtcttcaagccataccaggcctcccagcatgacatgt
- Show more
|
Description: A cloning plasmid for the HDAC3 gene. |
HDAC3 Polyclonal Antibody |
ABP51501-003ml |
Abbkine |
0.03ml |
EUR 158.00 |
- Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
- Applications tips:
|
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424 |
HDAC3 Polyclonal Antibody |
ABP51501-01ml |
Abbkine |
0.1ml |
EUR 289.00 |
- Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
- Applications tips:
|
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424 |
HDAC3 Polyclonal Antibody |
ABP51501-02ml |
Abbkine |
0.2ml |
EUR 414.00 |
- Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
- Applications tips:
|
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424 |
HDAC3 Polyclonal Antibody |
A68305 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
HDAC3 Rabbit mAb |
A19537-100ul |
Abclonal |
100 ul |
EUR 410.00 |
HDAC3 Rabbit mAb |
A19537-200ul |
Abclonal |
200 ul |
EUR 571.00 |
HDAC3 Rabbit mAb |
A19537-20ul |
Abclonal |
20 ul |
EUR 221.00 |
HDAC3 Rabbit mAb |
A19537-50ul |
Abclonal |
50 ul |
EUR 287.00 |
HDAC3 Rabbit pAb |
A2139-100ul |
Abclonal |
100 ul |
EUR 308.00 |
HDAC3 Rabbit pAb |
A2139-200ul |
Abclonal |
200 ul |
EUR 459.00 |
HDAC3 Rabbit pAb |
A2139-20ul |
Abclonal |
20 ul |
EUR 183.00 |
HDAC3 Rabbit pAb |
A2139-50ul |
Abclonal |
50 ul |
EUR 223.00 |
HDAC3 Mouse mAb |
A2603-100ul |
Abclonal |
100 ul |
EUR 384.00 |
HDAC3 Mouse mAb |
A2603-200ul |
Abclonal |
200 ul |
EUR 554.00 |
HDAC3 Mouse mAb |
A2603-20ul |
Abclonal |
20 ul |
Ask for price |
HDAC3 Mouse mAb |
A2603-50ul |
Abclonal |
50 ul |
EUR 265.00 |
HDAC3 Rabbit pAb |
A16462-100ul |
Abclonal |
100 ul |
EUR 308.00 |
HDAC3 Rabbit pAb |
A16462-200ul |
Abclonal |
200 ul |
EUR 459.00 |
HDAC3 Rabbit pAb |
A16462-20ul |
Abclonal |
20 ul |
EUR 183.00 |
HDAC3 Rabbit pAb |
A16462-50ul |
Abclonal |
50 ul |
EUR 223.00 |
anti- HDAC3 antibody |
FNab03798 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- IF: 1:50 - 1:200
- IP: 1:50 - 1:200
- ChIP: 1:20 - 1:100
- Immunogen: histone deacetylase 3
- Uniprot ID: O15379
- Gene ID: 8841
- Research Area: Epigenetics, Cardiovascular, Metabolism
|
Description: Antibody raised against HDAC3 |
HDAC3 Polyclonal Antibody |
ES2500-100ul |
ELK Biotech |
100ul |
EUR 279.00 |
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
HDAC3 Polyclonal Antibody |
ES2500-50ul |
ELK Biotech |
50ul |
EUR 207.00 |
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Anti-HDAC3 Antibody |
PA1600 |
BosterBio |
100ug/vial |
EUR 334.00 |
Anti-HDAC3 Antibody |
PA1600-1 |
BosterBio |
100ug/vial |
EUR 334.00 |
anti-HDAC3 (3E11) |
LF-MA10133 |
Abfrontier |
100 ug |
EUR 363.00 |
Description: Mouse monoclonal to HDAC3 |
anti-HDAC3 (7G6C5) |
LF-MA30212 |
Abfrontier |
100 ul |
EUR 537.00 |
Description: Mouse Monoclonal to HDAC3 |
anti-HDAC3 (3A7B5) |
LF-MA30213 |
Abfrontier |
100 ul |
EUR 537.00 |
Description: Mouse Monoclonal to HDAC3 |
Anti-HDAC3 antibody |
STJ114416 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. |
Anti-HDAC3 antibody |
STJ29889 |
St John's Laboratory |
100 µl |
EUR 393.00 |
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. |
Anti-HDAC3 antibody |
STJ23930 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. |
Anti-HDAC3 antibody |
STJ93479 |
St John's Laboratory |
200 µl |
EUR 197.00 |
Description: Rabbit polyclonal to HDAC3. |
Anti-HDAC3 antibody |
STJ98129 |
St John's Laboratory |
100 µl |
EUR 234.00 |
Description: Mouse monoclonal to HDAC3. |
Anti-HDAC3 antibody |
STJ98130 |
St John's Laboratory |
100 µl |
EUR 234.00 |
Description: Mouse monoclonal to HDAC3. |
Anti-HDAC3 antibody |
STJ98496 |
St John's Laboratory |
100 µl |
EUR 234.00 |
Description: Mouse monoclonal to HDAC3. |
Anti-HDAC3 antibody |
STJ99157 |
St John's Laboratory |
200 µl |
EUR 197.00 |
Description: Mouse monoclonal to HDAC3. |
Anti-HDAC3 (2A3) |
YF-MA16552 |
Abfrontier |
100 ug |
EUR 363.00 |
Description: Mouse monoclonal to HDAC3 |
HDAC3 (Phospho-Ser424) Antibody |
12045-100ul |
SAB |
100ul |
EUR 252.00 |
HDAC3 (Phospho-Ser424) Antibody |
12045-50ul |
SAB |
50ul |
EUR 187.00 |
Phospho-HDAC3 (Ser424) Antibody |
CSB-PA170084- |
Cusabio |
|
EUR 335.00 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
- Show more
|
Description: A polyclonal antibody against Phospho-HDAC3 (Ser424). Recognizes Phospho-HDAC3 (Ser424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
Phospho-HDAC3 (Ser424) Antibody |
CSB-PA170084-100ul |
Cusabio |
100ul |
EUR 362.00 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
- Show more
|
Description: A polyclonal antibody against Phospho-HDAC3 (Ser424). Recognizes Phospho-HDAC3 (Ser424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
HDAC3 Monoclonal Antibody [A10B1] |
A-4003 |
EpiGentek |
100 µl |
EUR 616.95 |
Description: The best epigenetics products |
Phospho-HDAC3 (Ser424) Antibody |
AF3016 |
Affbiotech |
200ul |
EUR 304.00 |
Description: Phospho-HDAC3 (Ser424) Antibody detects endogenous levels of HDAC3 only when phosphorylated at Serine 424. |
Rat HDAC3 shRNA Plasmid |
20-abx986973 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HDAC3 Conjugated Monoclonal Antibody |
C27125 |
SAB |
100ul |
EUR 397.00 |
Phospho-HDAC3 (S424) Antibody |
1-CSB-PA010572 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-HDAC3 (S424). Recognizes Phospho-HDAC3 (S424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
HDAC3 Antibody, HRP conjugated |
1-CSB-PA010239LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
HDAC3 Antibody, FITC conjugated |
1-CSB-PA010239LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
HDAC3 Antibody, Biotin conjugated |
1-CSB-PA010239LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
HDAC3 Cell ELISA Kit |
abx595276-96tests |
Abbexa |
96 tests |
EUR 637.00 |
- Shipped within 1-2 weeks.
|
Human HDAC3 shRNA Plasmid |
20-abx955837 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HDAC3 recombinant monoclonal antibody |
A5645 |
Bimake |
100ul X 3 |
EUR 595.00 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human HDAC3 for WB ,ELISA |
anti- HDAC3-specific antibody |
FNab03799 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- Immunogen: histone deacetylase 3
- Uniprot ID: O15379
- Research Area: Epigenetics, Cardiovascular, Metabolism
|
Description: Antibody raised against HDAC3-specific |
HDAC3 Recombinant Protein (Human) |
RP014497 |
ABM |
100 ug |
Ask for price |
HDAC3 Recombinant Protein (Rat) |
RP204341 |
ABM |
100 ug |
Ask for price |
HDAC3 Recombinant Protein (Mouse) |
RP141104 |
ABM |
100 ug |
Ask for price |
Anti-HDAC3 (2F9-4B7) |
YF-MA16550 |
Abfrontier |
100 ug |
EUR 363.00 |
Description: Mouse monoclonal to HDAC3 |
Histone Deacetylase 3(HDAC3) Antibody |
48123-100ul |
SAB |
100ul |
EUR 333.00 |
Histone Deacetylase 3(HDAC3) Antibody |
48123-50ul |
SAB |
50ul |
EUR 239.00 |
HDAC3 Inhibitor Drug Screening Kit |
55R-1385 |
Fitzgerald |
100 assays |
EUR 876.00 |
Description: Screening Kit for detection of HDAC3 Inhibitor in the research laboratory |
Human Histone deacetylase 3 (HDAC3) |
1-CSB-EP010239HU |
Cusabio |
- EUR 380.00
- EUR 214.00
- EUR 1309.00
- EUR 560.00
- EUR 873.00
- EUR 262.00
|
|
- MW: 64.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Histone deacetylase 3(HDAC3) expressed in E.coli |
Histone Deacetylase 3 (HDAC3) Antibody |
20-abx008479 |
Abbexa |
- EUR 300.00
- EUR 439.00
- EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Histone Deacetylase 3 (HDAC3) Antibody |
abx018176-100ug |
Abbexa |
100 ug |
EUR 342.00 |
- Shipped within 5-10 working days.
|
Histone Deacetylase 3 (HDAC3) Antibody |
abx015752-100ul |
Abbexa |
100 ul |
EUR 411.00 |
- Shipped within 5-10 working days.
|
Histone Deacetylase 3 (HDAC3) Antibody |
20-abx113033 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Histone Deacetylase 3 (HDAC3) Antibody |
20-abx123261 |
Abbexa |
- EUR 495.00
- EUR 704.00
- EUR 356.00
|
|
- Shipped within 5-10 working days.
|
Histone Deacetylase 3 (HDAC3) Antibody |
abx036046-100ug |
Abbexa |
100 ug |
EUR 391.00 |
- Shipped within 5-10 working days.
|
Histone Deacetylase 3 (HDAC3) Antibody |
20-abx109304 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Histone Deacetylase 3 (HDAC3) Antibody |
abx159527-100ul |
Abbexa |
100 ul |
EUR 467.00 |
- Shipped within 5-10 working days.
|
In an automated fashion, single worms were synchronized, isolated, and cultured from egg to adulthood in a microfluidic device, where their identity was preserved during their whole development. Several phenotypes were monitored and quantified for each animal, resulting in high-content phenome data.