Microfluidics-enabled phenotyping of a whole population of C. elegans worms over their embryonic and post-embryonic development at single-organism resolution.

The organism Caenorhabditis elegans is a performant model system for studying human biological processes and diseases, but until now all phenome data are produced as population-averaged read-outs.

Monitoring of individual responses to drug treatments would however be more informative. Here, a new strategy to track different phenotypic traits of individual C. elegans nematodes throughout their full life-cycle-i.e., embryonic and post-embryonic development, until adulthood onset, differently from life-span-is presented.

Human Histone Deacetylase 3 (HDAC3) ELISA kit

RDR-HDAC3-Hu-48Tests 48 Tests
EUR 544

Human Histone Deacetylase 3 (HDAC3) ELISA kit

RDR-HDAC3-Hu-96Tests 96 Tests
EUR 756

Hdac3/ Rat Hdac3 ELISA Kit

ELI-27737r 96 Tests
EUR 886

HDAC3 antibody

20R-2774 50 ug
EUR 281
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody  

21660-100ul 100ul
EUR 252

HDAC3 Antibody  

21660-50ul 50ul
EUR 187

HDAC3 Antibody

31216-100ul 100ul
EUR 252

HDAC3 Antibody

31216-50ul 50ul
EUR 187

HDAC3 antibody

70R-17706 50 ul
EUR 435
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

70R-11943 100 ug
EUR 403
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

70R-31225 100 ug
EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody

EUR 338

HDAC3 Antibody

EUR 146

HDAC3 antibody

70R-14137 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody

33400-100ul 100ul
EUR 252

HDAC3 Antibody

33400-50ul 50ul
EUR 187

HDAC3 Antibody

EUR 316

HDAC3 Antibody

EUR 146

HDAC3 Antibody

32620-100ul 100ul
EUR 252

HDAC3 antibody

10R-2003 100 ul
EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody

10R-2004 100 ul
EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody

10R-10389 100 ug
EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 Antibody

48964-100ul 100ul
EUR 333

HDAC3 Antibody

48964-50ul 50ul
EUR 239

HDAC3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

HDAC3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HDAC3 Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody

CSB-PA916163-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody

CSB-PA967736-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

HDAC3 Antibody

DF6862 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

Hdac3 antibody

70R-8546 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Hdac3 antibody

HDAC3 antibody

70R-33611 100 ug
EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Protein

E24006 50 µg
EUR 806.9
Description: fast delivery possible

HDAC3 Antibody

AF0733 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of HDAC3.

HDAC3 Antibody

AF5349 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

AF6016 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

BF0230 200ul
EUR 376
Description: HDAC3 antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HDAC3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDAC3 Antibody

ABF5349 100 ug
EUR 438

HDAC3 Antibody

ABF6016 100 ug
EUR 438

HDAC3 Antibody

ABD6862 100 ug
EUR 438

HDAC3 Antibody

ABF0733 100 ug
EUR 438


PVT18724 2 ug
EUR 231


YF-PA15910 50 ul
EUR 363
Description: Mouse polyclonal to HDAC3


YF-PA15911 100 ul
EUR 403
Description: Rabbit polyclonal to HDAC3


YF-PA15912 100 ug
EUR 403
Description: Rabbit polyclonal to HDAC3


YF-PA25204 50 ul
EUR 334
Description: Mouse polyclonal to HDAC3


YF-PA25205 50 ul
EUR 334
Description: Mouse polyclonal to HDAC3

HDAC3 Monoclonal Antibody

27125-100ul 100ul
EUR 252

HDAC3 Monoclonal Antibody

27125-50ul 50ul
EUR 187

HDAC3 Rabbit pAb

A12542-100ul 100 ul
EUR 308

HDAC3 Rabbit pAb

A12542-200ul 200 ul
EUR 459

HDAC3 Rabbit pAb

A12542-20ul 20 ul
EUR 183

HDAC3 Rabbit pAb

A12542-50ul 50 ul
EUR 223

Hdac3 Blocking Peptide

33R-2222 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hdac3 antibody, catalog no. 70R-8546

HDAC3 Blocking Peptide

33R-10828 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HDAC3 antibody, catalog no. 70R-11943

HDAC3 Polyclonal Antibody

40996-100ul 100ul
EUR 252

HDAC3 Polyclonal Antibody

40996-50ul 50ul
EUR 187

HDAC3 Assay Kit

55R-1377 100 assays
EUR 693
Description: Assay Kit for detection of HDAC3 in the research laboratory

HDAC3 Blocking Peptide

DF6862-BP 1mg
EUR 195

Anti-HDAC3 Antibody

A00839 100ug/vial
EUR 294

HDAC3 antibody (Ser424)

70R-33610 100 ug
EUR 327
Description: Rabbit polyclonal HDAC3 antibody (Ser424)

HDAC3 (pS424) Antibody

abx010928-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

HDAC3 Blocking Peptide

AF0733-BP 1mg
EUR 195

HDAC3 Blocking Peptide

AF5349-BP 1mg
EUR 195

HDAC3 Blocking Peptide

AF6016-BP 1mg
EUR 195

HDAC3 Conjugated Antibody

C32620 100ul
EUR 397

HDAC3 Conjugated Antibody

C31216 100ul
EUR 397

HDAC3 Blocking Peptide

BF0230-BP 1mg
EUR 195

HDAC3-specific Antibody

abx233799-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

HDAC3 (pS424) Antibody

abx333379-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Polyclonal HDAC3 Antibody

AMM05315G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Polyclonal HDAC3 Antibody

AMM05316G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Monoclonal HDAC3 Antibody

AMM05317G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human HDAC3. The antibodies are raised in Mouse. This antibody is applicable in WB

HDAC3 cloning plasmid

CSB-CL010239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1287
  • Sequence: atggccaagaccgtggcctatttctacgaccccgacgtgggcaacttccactacggagctggacaccctatgaagccccatcgcctggcattgacccatagcctggtcctgcattacggtctctataagaagatgatcgtcttcaagccataccaggcctcccagcatgacatgt
  • Show more
Description: A cloning plasmid for the HDAC3 gene.

HDAC3 Polyclonal Antibody

ABP51501-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
  • Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody

ABP51501-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
  • Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody

ABP51501-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
  • Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody

A68305 100 µg
EUR 570.55
Description: reagents widely cited

HDAC3 Rabbit mAb

A19537-100ul 100 ul
EUR 410

HDAC3 Rabbit mAb

A19537-200ul 200 ul
EUR 571

HDAC3 Rabbit mAb

A19537-20ul 20 ul
EUR 221

HDAC3 Rabbit mAb

A19537-50ul 50 ul
EUR 287

HDAC3 Rabbit pAb

A2139-100ul 100 ul
EUR 308

HDAC3 Rabbit pAb

A2139-200ul 200 ul
EUR 459

HDAC3 Rabbit pAb

A2139-20ul 20 ul
EUR 183

HDAC3 Rabbit pAb

A2139-50ul 50 ul
EUR 223

HDAC3 Mouse mAb

A2603-100ul 100 ul
EUR 384

HDAC3 Mouse mAb

A2603-200ul 200 ul
EUR 554

HDAC3 Mouse mAb

A2603-20ul 20 ul Ask for price

HDAC3 Mouse mAb

A2603-50ul 50 ul
EUR 265

HDAC3 Rabbit pAb

A16462-100ul 100 ul
EUR 308

HDAC3 Rabbit pAb

A16462-200ul 200 ul
EUR 459

HDAC3 Rabbit pAb

A16462-20ul 20 ul
EUR 183

HDAC3 Rabbit pAb

A16462-50ul 50 ul
EUR 223

anti- HDAC3 antibody

FNab03798 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:50 - 1:200
  • IP: 1:50 - 1:200
  • ChIP: 1:20 - 1:100
  • Immunogen: histone deacetylase 3
  • Uniprot ID: O15379
  • Gene ID: 8841
  • Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against HDAC3

HDAC3 Polyclonal Antibody

ES2500-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

HDAC3 Polyclonal Antibody

ES2500-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-HDAC3 Antibody

PA1600 100ug/vial
EUR 334

Anti-HDAC3 Antibody

PA1600-1 100ug/vial
EUR 334

anti-HDAC3 (3E11)

LF-MA10133 100 ug
EUR 363
Description: Mouse monoclonal to HDAC3

anti-HDAC3 (7G6C5)

LF-MA30212 100 ul
EUR 537
Description: Mouse Monoclonal to HDAC3

anti-HDAC3 (3A7B5)

LF-MA30213 100 ul
EUR 537
Description: Mouse Monoclonal to HDAC3

Anti-HDAC3 antibody

PAab03798 100 ug
EUR 355

pENTR223-HDAC3 vector

PVT12125 2 ug
EUR 308

Anti-HDAC3 antibody

STJ114416 100 µl
EUR 277
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody

STJ118902 100 µl
EUR 277

Anti-HDAC3 antibody

STJ29889 100 µl
EUR 393
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody

STJ23930 100 µl
EUR 277
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody

STJ93479 200 µl
EUR 197
Description: Rabbit polyclonal to HDAC3.

Anti-HDAC3 antibody

STJ73163 100 µg
EUR 359

Anti-HDAC3 antibody

STJ98129 100 µl
EUR 234
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ98130 100 µl
EUR 234
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ98496 100 µl
EUR 234
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ99157 200 µl
EUR 197
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 (2A3)

YF-MA16552 100 ug
EUR 363
Description: Mouse monoclonal to HDAC3

HDAC3 (Phospho-Ser424) Antibody

12045-100ul 100ul
EUR 252

HDAC3 (Phospho-Ser424) Antibody

12045-50ul 50ul
EUR 187

Phospho-HDAC3 (Ser424) Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-HDAC3 (Ser424). Recognizes Phospho-HDAC3 (Ser424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-HDAC3 (Ser424) Antibody

CSB-PA170084-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-HDAC3 (Ser424). Recognizes Phospho-HDAC3 (Ser424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Monoclonal Antibody [A10B1]

A-4003 100 µl
EUR 616.95
Description: The best epigenetics products

Phospho-HDAC3 (Ser424) Antibody

AF3016 200ul
EUR 304
Description: Phospho-HDAC3 (Ser424) Antibody detects endogenous levels of HDAC3 only when phosphorylated at Serine 424.

Rat HDAC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HDAC3 Conjugated Monoclonal Antibody

C27125 100ul
EUR 397

Phospho-HDAC3 (S424) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-HDAC3 (S424). Recognizes Phospho-HDAC3 (S424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

HDAC3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HDAC3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HDAC3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


abx595276-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human HDAC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho- HDAC3 (Ser424) Antibody

ABF3016 100 ug
EUR 438

HDAC3 recombinant monoclonal antibody

A5645 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human HDAC3 for WB ,ELISA

anti- HDAC3-specific antibody

FNab03799 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: histone deacetylase 3
  • Uniprot ID: O15379
  • Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against HDAC3-specific

Anti-HDAC3-specific antibody

PAab03799 100 ug
EUR 386


PVT12645 2 ug
EUR 703

HDAC3 Recombinant Protein (Human)

RP014497 100 ug Ask for price

HDAC3 Recombinant Protein (Rat)

RP204341 100 ug Ask for price

HDAC3 Recombinant Protein (Mouse)

RP141104 100 ug Ask for price

Anti-HDAC3 (2F9-4B7)

YF-MA16550 100 ug
EUR 363
Description: Mouse monoclonal to HDAC3

Histone Deacetylase 3(HDAC3) Antibody

48123-100ul 100ul
EUR 333

Histone Deacetylase 3(HDAC3) Antibody

48123-50ul 50ul
EUR 239

HDAC3 Inhibitor Drug Screening Kit

55R-1385 100 assays
EUR 876
Description: Screening Kit for detection of HDAC3 Inhibitor in the research laboratory

Human Histone deacetylase 3 (HDAC3)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 64.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Histone deacetylase 3(HDAC3) expressed in E.coli

Histone Deacetylase 3 (HDAC3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Histone Deacetylase 3 (HDAC3) Antibody

abx018176-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Histone Deacetylase 3 (HDAC3) Antibody

abx015752-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Histone Deacetylase 3 (HDAC3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Histone Deacetylase 3 (HDAC3) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Histone Deacetylase 3 (HDAC3) Antibody

abx036046-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Histone Deacetylase 3 (HDAC3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histone Deacetylase 3 (HDAC3) Antibody

abx159527-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

In an automated fashion, single worms were synchronized, isolated, and cultured from egg to adulthood in a microfluidic device, where their identity was preserved during their whole development. Several phenotypes were monitored and quantified for each animal, resulting in high-content phenome data. 
