Microfluidics-enabled phenotyping of a whole population of C. elegans worms over their embryonic and post-embryonic development at single-organism resolution.

The organism Caenorhabditis elegans is a performant model system for studying human biological processes and diseases, but until now all phenome data are produced as population-averaged read-outs.

Monitoring of individual responses to drug treatments would however be more informative. Here, a new strategy to track different phenotypic traits of individual C. elegans nematodes throughout their full life-cycle-i.e., embryonic and post-embryonic development, until adulthood onset, differently from life-span-is presented.

Human Histone Deacetylase 3 (HDAC3) ELISA kit
RDR-HDAC3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Histone Deacetylase 3 (HDAC3) ELISA kit
RDR-HDAC3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Hdac3/ Rat Hdac3 ELISA Kit
ELI-27737r	Lifescience Market	96 Tests	EUR 886

HDAC3 Antibody
AF5349	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
AF6016	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
BF0230	Affbiotech	200ul	EUR 376
Description: HDAC3 antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
AF0733	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of HDAC3.

HDAC3 Protein
E24006	EpiGentek	50 µg	EUR 806.9
Description: fast delivery possible

HDAC3 Antibody
ABF5349	Lifescience Market	100 ug	EUR 438

HDAC3 Antibody
ABF6016	Lifescience Market	100 ug	EUR 438

HDAC3 Antibody
ABF0733	Lifescience Market	100 ug	EUR 438

HDAC3 siRNA
20-abx919179	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HDAC3 siRNA
20-abx919180	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HDAC3 antibody
70R-33611	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody
70R-31225	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HDAC3 antibody

Hdac3 antibody
70R-8546	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Hdac3 antibody

HDAC3 Antibody
ABD6862	Lifescience Market	100 ug	EUR 438

HDAC3 Antibody
3603-100	Biovision		EUR 316

HDAC3 Antibody
3603-30T	Biovision		EUR 146

HDAC3 Antibody
33400-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
33400-50ul	SAB	50ul	EUR 187

HDAC3 Antibody
48964-100ul	SAB	100ul	EUR 333

HDAC3 Antibody
48964-50ul	SAB	50ul	EUR 239

HDAC3 antibody
10R-10389	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 Antibody
31216-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
31216-50ul	SAB	50ul	EUR 187

HDAC3 Antibody
32620-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
21660-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
21660-50ul	SAB	50ul	EUR 187

HDAC3 antibody
10R-2003	Fitzgerald	100 ul	EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody
10R-2004	Fitzgerald	100 ul	EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody
20R-2774	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody
6603-100	Biovision		EUR 338

HDAC3 Antibody
6603-30T	Biovision		EUR 146

HDAC3 antibody
70R-17706	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody
70R-11943	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody
70R-14137	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody
DF6862	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
1-CSB-PA899967	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

HDAC3 Antibody
CSB-PA916163-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody
CSB-PA916163-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody
CSB-PA967736-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody
CSB-PA967736-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody
1-CSB-PA002880	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

HDAC3 Antibody
1-CSB-PA004117	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HDAC3 Antibody
1-CSB-PA010239GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HDAC3 Antibody
1-CSB-PA010239LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

pOTB7-HDAC3
PVT18724	Lifescience Market	2 ug	EUR 231

anti-HDAC3
YF-PA15910	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to HDAC3

anti-HDAC3
YF-PA15911	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to HDAC3

anti-HDAC3
YF-PA15912	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to HDAC3

anti-HDAC3
YF-PA25204	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to HDAC3

anti-HDAC3
YF-PA25205	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to HDAC3

HDAC3 Blocking Peptide
AF5349-BP	Affbiotech	1mg	EUR 195

HDAC3 Blocking Peptide
AF6016-BP	Affbiotech	1mg	EUR 195

Polyclonal HDAC3 Antibody
AMM05315G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Polyclonal HDAC3 Antibody
AMM05316G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Monoclonal HDAC3 Antibody
AMM05317G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human HDAC3. The antibodies are raised in Mouse. This antibody is applicable in WB

HDAC3 Blocking Peptide
BF0230-BP	Affbiotech	1mg	EUR 195

HDAC3 Conjugated Antibody
C32620	SAB	100ul	EUR 397

HDAC3 Conjugated Antibody
C31216	SAB	100ul	EUR 397

HDAC3 Blocking Peptide
AF0733-BP	Affbiotech	1mg	EUR 195

HDAC3 cloning plasmid
CSB-CL010239HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1287 Sequence: atggccaagaccgtggcctatttctacgaccccgacgtgggcaacttccactacggagctggacaccctatgaagccccatcgcctggcattgacccatagcctggtcctgcattacggtctctataagaagatgatcgtcttcaagccataccaggcctcccagcatgacatgt Show more
Description: A cloning plasmid for the HDAC3 gene.

HDAC3 Polyclonal Antibody
ES2500-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

HDAC3 Polyclonal Antibody
ES2500-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti- HDAC3 antibody
FNab03798	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 IF: 1:50 - 1:200 IP: 1:50 - 1:200 ChIP: 1:20 - 1:100 Immunogen: histone deacetylase 3 Uniprot ID: O15379 Gene ID: 8841 Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against HDAC3

HDAC3 (pS424) Antibody
abx010928-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

HDAC3 Polyclonal Antibody
ABP51501-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424 Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody
ABP51501-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424 Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody
ABP51501-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424 Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 (pS424) Antibody
abx333379-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

HDAC3-specific Antibody
abx233799-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Anti-HDAC3 Antibody
A00839	BosterBio	100ug/vial	EUR 294

HDAC3 Rabbit pAb
A12542-100ul	Abclonal	100 ul	EUR 308

HDAC3 Rabbit pAb
A12542-200ul	Abclonal	200 ul	EUR 459

HDAC3 Rabbit pAb
A12542-20ul	Abclonal	20 ul	EUR 183

HDAC3 Rabbit pAb
A12542-50ul	Abclonal	50 ul	EUR 223

HDAC3 antibody (Ser424)
70R-33610	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HDAC3 antibody (Ser424)

HDAC3 Rabbit mAb
A19537-100ul	Abclonal	100 ul	EUR 410

HDAC3 Rabbit mAb
A19537-200ul	Abclonal	200 ul	EUR 571

HDAC3 Rabbit mAb
A19537-20ul	Abclonal	20 ul	EUR 221

HDAC3 Rabbit mAb
A19537-50ul	Abclonal	50 ul	EUR 287

HDAC3 Rabbit pAb
A16462-100ul	Abclonal	100 ul	EUR 308

HDAC3 Rabbit pAb
A16462-200ul	Abclonal	200 ul	EUR 459

HDAC3 Rabbit pAb
A16462-20ul	Abclonal	20 ul	EUR 183

HDAC3 Rabbit pAb
A16462-50ul	Abclonal	50 ul	EUR 223

HDAC3 Mouse mAb
A2603-100ul	Abclonal	100 ul	EUR 384

HDAC3 Mouse mAb
A2603-200ul	Abclonal	200 ul	EUR 554

HDAC3 Mouse mAb
A2603-20ul	Abclonal	20 ul	Ask for price

HDAC3 Mouse mAb
A2603-50ul	Abclonal	50 ul	EUR 265

HDAC3 Rabbit pAb
A2139-100ul	Abclonal	100 ul	EUR 308

HDAC3 Rabbit pAb
A2139-200ul	Abclonal	200 ul	EUR 459

HDAC3 Rabbit pAb
A2139-20ul	Abclonal	20 ul	EUR 183

HDAC3 Rabbit pAb
A2139-50ul	Abclonal	50 ul	EUR 223

HDAC3 Polyclonal Antibody
A68305	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

HDAC3 Blocking Peptide
33R-10828	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HDAC3 antibody, catalog no. 70R-11943

Hdac3 Blocking Peptide
33R-2222	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hdac3 antibody, catalog no. 70R-8546

HDAC3 Polyclonal Antibody
40996-100ul	SAB	100ul	EUR 252

HDAC3 Polyclonal Antibody
40996-50ul	SAB	50ul	EUR 187

HDAC3 Monoclonal Antibody
27125-100ul	SAB	100ul	EUR 252

HDAC3 Monoclonal Antibody
27125-50ul	SAB	50ul	EUR 187

HDAC3 Assay Kit
55R-1377	Fitzgerald	100 assays	EUR 693
Description: Assay Kit for detection of HDAC3 in the research laboratory

HDAC3 Blocking Peptide
DF6862-BP	Affbiotech	1mg	EUR 195

Anti-HDAC3 antibody
PAab03798	Lifescience Market	100 ug	EUR 355

anti-HDAC3 (3E11)
LF-MA10133	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HDAC3

anti-HDAC3 (7G6C5)
LF-MA30212	Abfrontier	100 ul	EUR 537
Description: Mouse Monoclonal to HDAC3

anti-HDAC3 (3A7B5)
LF-MA30213	Abfrontier	100 ul	EUR 537
Description: Mouse Monoclonal to HDAC3

Anti-HDAC3 Antibody
PA1600	BosterBio	100ug/vial	EUR 334

Anti-HDAC3 Antibody
PA1600-1	BosterBio	100ug/vial	EUR 334

pENTR223-HDAC3 vector
PVT12125	Lifescience Market	2 ug	EUR 308

Anti-HDAC3 antibody
STJ73163	St John's Laboratory	100 µg	EUR 359

Anti-HDAC3 antibody
STJ93479	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to HDAC3.

Anti-HDAC3 antibody
STJ98129	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody
STJ98130	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody
STJ98496	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody
STJ99157	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody
STJ29889	St John's Laboratory	100 µl	EUR 393
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody
STJ23930	St John's Laboratory	100 µl	EUR 277
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody
STJ114416	St John's Laboratory	100 µl	EUR 277
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody
STJ118902	St John's Laboratory	100 µl	EUR 277

Anti-HDAC3 (2A3)
YF-MA16552	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HDAC3

Phospho-HDAC3 (Ser424) Antibody
AF3016	Affbiotech	200ul	EUR 304
Description: Phospho-HDAC3 (Ser424) Antibody detects endogenous levels of HDAC3 only when phosphorylated at Serine 424.

HDAC3 Cell ELISA Kit
abx595276-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

HDAC3 Conjugated Monoclonal Antibody
C27125	SAB	100ul	EUR 397

Rat HDAC3 shRNA Plasmid
20-abx986973	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

anti- HDAC3-specific antibody
FNab03799	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 Immunogen: histone deacetylase 3 Uniprot ID: O15379 Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against HDAC3-specific

Phospho- HDAC3 (Ser424) Antibody
ABF3016	Lifescience Market	100 ug	EUR 438

Human HDAC3 shRNA Plasmid
20-abx955837	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HDAC3 Monoclonal Antibody [A10B1]
A-4003	EpiGentek	100 µl	EUR 616.95
Description: The best epigenetics products

HDAC3 recombinant monoclonal antibody
A5645	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human HDAC3 for WB ,ELISA

HDAC3 (Phospho-Ser424) Antibody
12045-100ul	SAB	100ul	EUR 252

HDAC3 (Phospho-Ser424) Antibody
12045-50ul	SAB	50ul	EUR 187

Phospho-HDAC3 (S424) Antibody
1-CSB-PA010572	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-HDAC3 (S424). Recognizes Phospho-HDAC3 (S424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

HDAC3 Antibody, HRP conjugated
1-CSB-PA010239LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HDAC3 Antibody, FITC conjugated
1-CSB-PA010239LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HDAC3 Antibody, Biotin conjugated
1-CSB-PA010239LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-HDAC3 (Ser424) Antibody
CSB-PA170084-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-HDAC3 (Ser424). Recognizes Phospho-HDAC3 (Ser424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-HDAC3 (Ser424) Antibody
CSB-PA170084-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-HDAC3 (Ser424). Recognizes Phospho-HDAC3 (Ser424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Anti-HDAC3-specific antibody
PAab03799	Lifescience Market	100 ug	EUR 386

HDAC3 Recombinant Protein (Human)
RP014497	ABM	100 ug	Ask for price

pECMV-3-FLAG-HDAC3
PVT12645	Lifescience Market	2 ug	EUR 703

HDAC3 Recombinant Protein (Rat)
RP204341	ABM	100 ug	Ask for price

HDAC3 Recombinant Protein (Mouse)
RP141104	ABM	100 ug	Ask for price

Anti-HDAC3 (2F9-4B7)
YF-MA16550	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HDAC3

Phospho-HDAC3 (Ser424) Blocking Peptide
AF3016-BP	Affbiotech	1mg	EUR 195

Polyclonal HDAC3 Antibody (aa2-17)
AMM05318G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 (aa2-17). This antibody is tested and proven to work in the following applications:

Monoclonal HDAC3 Antibody, Clone: 7G6C5
APR12334G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human HDAC3. The antibodies are raised in Mouse and are from clone 7G6C5. This antibody is applicable in WB, ICC, E

HDAC3 (phospho Ser424) Polyclonal Antibody
ES7887-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HDAC3 (phospho Ser424) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

HDAC3 (phospho Ser424) Polyclonal Antibody
ES7887-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HDAC3 (phospho Ser424) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Histone Deacetylase 3 (HDAC3) Antibody
20-abx123261	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Histone Deacetylase 3 (HDAC3) Antibody
20-abx113033	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Histone Deacetylase 3 (HDAC3) Antibody
20-abx109304	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

HDAC3 (phospho Ser424) Polyclonal Antibody
ABP56888-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human HDAC3 around the phosphorylation site of S424 Applications tips:
Description: A polyclonal antibody for detection of HDAC3 phospho Ser424) from Human, Mouse, Rat. This HDAC3 phospho Ser424) antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the phosphorylation site of S424

HDAC3 (phospho Ser424) Polyclonal Antibody
ABP56888-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human HDAC3 around the phosphorylation site of S424 Applications tips:
Description: A polyclonal antibody for detection of HDAC3 phospho Ser424) from Human, Mouse, Rat. This HDAC3 phospho Ser424) antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the phosphorylation site of S424

HDAC3 (phospho Ser424) Polyclonal Antibody
ABP56888-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human HDAC3 around the phosphorylation site of S424 Applications tips:
Description: A polyclonal antibody for detection of HDAC3 phospho Ser424) from Human, Mouse, Rat. This HDAC3 phospho Ser424) antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the phosphorylation site of S424

Histone Deacetylase 3 (HDAC3) Antibody
20-abx001751	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

In an automated fashion, single worms were synchronized, isolated, and cultured from egg to adulthood in a microfluidic device, where their identity was preserved during their whole development. Several phenotypes were monitored and quantified for each animal, resulting in high-content phenome data.