Microfluidics-enabled phenotyping of a whole population of C. elegans worms over their embryonic and post-embryonic development at single-organism resolution.

The organism Caenorhabditis elegans is a performant model system for studying human biological processes and diseases, but until now all phenome data are produced as population-averaged read-outs.

Monitoring of individual responses to drug treatments would however be more informative. Here, a new strategy to track different phenotypic traits of individual C. elegans nematodes throughout their full life-cycle-i.e., embryonic and post-embryonic development, until adulthood onset, differently from life-span-is presented.

Human Histone Deacetylase 3 (HDAC3) ELISA kit

DL-HDAC3-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Histone Deacetylase 3 (HDAC3)

Human Histone Deacetylase 3 (HDAC3) ELISA kit

DLR-HDAC3-Hu-48T 48T
EUR 516.00
  • Should the Human Histone Deacetylase 3 (HDAC3) ELISA kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histone Deacetylase 3 (HDAC3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Histone Deacetylase 3 (HDAC3) ELISA kit

DLR-HDAC3-Hu-96T 96T
EUR 673.00
  • Should the Human Histone Deacetylase 3 (HDAC3) ELISA kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histone Deacetylase 3 (HDAC3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Histone Deacetylase 3 (HDAC3) ELISA kit

RDR-HDAC3-Hu-48Tests 48 Tests
EUR 544.00

Human Histone Deacetylase 3 (HDAC3) ELISA kit

RDR-HDAC3-Hu-96Tests 96 Tests
EUR 756.00

Hdac3/ Rat Hdac3 ELISA Kit

ELI-27737r 96 Tests
EUR 886.00

HDAC3 Antibody

AF6016 200ul
EUR 304.00
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

AF0733 200ul
EUR 304.00
Description: HDAC3 Antibody detects endogenous levels of HDAC3.

HDAC3 Antibody

AF5349 200ul
EUR 304.00
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

BF0230 200ul
EUR 376.00
Description: HDAC3 antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

1-CSB-PA002880
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

HDAC3 Antibody

1-CSB-PA004117
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HDAC3 Antibody

1-CSB-PA010239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HDAC3 Antibody

1-CSB-PA010239LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HDAC3 antibody

20R-2774 50 ug
EUR 281.00
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

10R-10389 100 ug
EUR 435.00
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody

10R-2003 100 ul
EUR 435.00
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody

10R-2004 100 ul
EUR 435.00
Description: Mouse monoclonal HDAC3 antibody

HDAC3 Antibody

33400-100ul 100ul
EUR 252.00

HDAC3 Antibody

33400-50ul 50ul
EUR 187.00

HDAC3 Antibody

31216-100ul 100ul
EUR 252.00

HDAC3 Antibody

31216-50ul 50ul
EUR 187.00

HDAC3 Antibody

32620-100ul 100ul
EUR 252.00

HDAC3 Antibody  

21660-100ul 100ul
EUR 252.00

HDAC3 Antibody  

21660-50ul 50ul
EUR 187.00

HDAC3 Antibody

3603-100
EUR 316.00

HDAC3 Antibody

3603-30T
EUR 146.00

HDAC3 antibody

70R-31225 100 ug
EUR 327.00
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

70R-33611 100 ug
EUR 327.00
Description: Rabbit polyclonal HDAC3 antibody

Hdac3 antibody

70R-8546 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal Hdac3 antibody

HDAC3 Antibody

ABF5349 100 ug
EUR 438.00

HDAC3 Antibody

ABF6016 100 ug
EUR 438.00

HDAC3 siRNA

20-abx919179
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDAC3 siRNA

20-abx919180
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDAC3 Antibody

1-CSB-PA899967
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

HDAC3 Antibody

CSB-PA916163-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody

CSB-PA916163-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody

CSB-PA967736-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody

CSB-PA967736-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody

DF6862 200ul
EUR 304.00
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

ABD6862 100 ug
EUR 438.00

HDAC3 Antibody

ABF0733 100 ug
EUR 438.00

HDAC3 antibody

70R-17706 50 ul
EUR 435.00
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

70R-11943 100 ug
EUR 403.00
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

70R-14137 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody

48964-100ul 100ul
EUR 333.00

HDAC3 Antibody

48964-50ul 50ul
EUR 239.00

HDAC3 Antibody

6603-100
EUR 338.00

HDAC3 Antibody

6603-30T
EUR 146.00

HDAC3 Protein

E24006 50 µg
EUR 806.90
Description: fast delivery possible

pOTB7-HDAC3

PVT18724 2 ug
EUR 231.00

anti-HDAC3

YF-PA15910 50 ul
EUR 363.00
Description: Mouse polyclonal to HDAC3

anti-HDAC3

YF-PA15911 100 ul
EUR 403.00
Description: Rabbit polyclonal to HDAC3

anti-HDAC3

YF-PA15912 100 ug
EUR 403.00
Description: Rabbit polyclonal to HDAC3

anti-HDAC3

YF-PA25204 50 ul
EUR 334.00
Description: Mouse polyclonal to HDAC3

anti-HDAC3

YF-PA25205 50 ul
EUR 334.00
Description: Mouse polyclonal to HDAC3

HDAC3 Blocking Peptide

AF6016-BP 1mg
EUR 195.00

HDAC3 Conjugated Antibody

C31216 100ul
EUR 397.00

HDAC3 Conjugated Antibody

C32620 100ul
EUR 397.00

HDAC3 Blocking Peptide

AF0733-BP 1mg
EUR 195.00

HDAC3 Blocking Peptide

AF5349-BP 1mg
EUR 195.00

HDAC3 Blocking Peptide

BF0230-BP 1mg
EUR 195.00

Polyclonal HDAC3 Antibody

AMM05315G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Polyclonal HDAC3 Antibody

AMM05316G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Monoclonal HDAC3 Antibody

AMM05317G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human HDAC3. The antibodies are raised in Mouse. This antibody is applicable in WB

HDAC3 cloning plasmid

CSB-CL010239HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1287
  • Sequence: atggccaagaccgtggcctatttctacgaccccgacgtgggcaacttccactacggagctggacaccctatgaagccccatcgcctggcattgacccatagcctggtcctgcattacggtctctataagaagatgatcgtcttcaagccataccaggcctcccagcatgacatgt
  • Show more
Description: A cloning plasmid for the HDAC3 gene.

HDAC3 Blocking Peptide

33R-10828 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HDAC3 antibody, catalog no. 70R-11943

Hdac3 Blocking Peptide

33R-2222 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hdac3 antibody, catalog no. 70R-8546

HDAC3 Monoclonal Antibody

27125-100ul 100ul
EUR 252.00

HDAC3 Monoclonal Antibody

27125-50ul 50ul
EUR 187.00

HDAC3 Polyclonal Antibody

40996-100ul 100ul
EUR 252.00

HDAC3 Polyclonal Antibody

40996-50ul 50ul
EUR 187.00

HDAC3 Polyclonal Antibody

A68305 100 µg
EUR 570.55
Description: reagents widely cited

HDAC3 antibody (Ser424)

70R-33610 100 ug
EUR 327.00
Description: Rabbit polyclonal HDAC3 antibody (Ser424)

HDAC3 Assay Kit

55R-1377 100 assays
EUR 693.00
Description: Assay Kit for detection of HDAC3 in the research laboratory

HDAC3 (pS424) Antibody

abx010928-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

HDAC3 Polyclonal Antibody

ABP51501-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
  • Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody

ABP51501-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
  • Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody

ABP51501-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
  • Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 (pS424) Antibody

abx333379-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

HDAC3-specific Antibody

abx233799-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

HDAC3 Polyclonal Antibody

E-AB-12502-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental ev
  • Show more
Description: Rabbit antibody against Human,Rat HDAC3 for WB,ELISA applications.

HDAC3 Polyclonal Antibody

E-AB-12502-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental ev
  • Show more
Description: Rabbit antibody against Human,Rat HDAC3 for WB,ELISA applications.

HDAC3 Polyclonal Antibody

E-AB-12502-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental ev
  • Show more
Description: Rabbit antibody against Human,Rat HDAC3 for WB,ELISA applications.

HDAC3 Polyclonal Antibody

E-AB-32924-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Responsible for the deacetylation of lysine residues on the N-terminal part of the core hist
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat,Monkey HDAC3 for WB,IHC-p,IF,ELISA applications.

HDAC3 Polyclonal Antibody

E-AB-32924-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Responsible for the deacetylation of lysine residues on the N-terminal part of the core hist
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat,Monkey HDAC3 for WB,IHC-p,IF,ELISA applications.

HDAC3 Polyclonal Antibody

E-AB-32924-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Responsible for the deacetylation of lysine residues on the N-terminal part of the core hist
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat,Monkey HDAC3 for WB,IHC-p,IF,ELISA applications.

HDAC3 Blocking Peptide

DF6862-BP 1mg
EUR 195.00

HDAC3 Rabbit pAb

A16462-100ul 100 ul
EUR 308.00

HDAC3 Rabbit pAb

A16462-200ul 200 ul
EUR 459.00

HDAC3 Rabbit pAb

A16462-20ul 20 ul
EUR 183.00

HDAC3 Rabbit pAb

A16462-50ul 50 ul
EUR 223.00

HDAC3 Rabbit pAb

A12542-100ul 100 ul
EUR 308.00

HDAC3 Rabbit pAb

A12542-200ul 200 ul
EUR 459.00

HDAC3 Rabbit pAb

A12542-20ul 20 ul
EUR 183.00

HDAC3 Rabbit pAb

A12542-50ul 50 ul
EUR 223.00

HDAC3 Rabbit mAb

A19537-100ul 100 ul
EUR 410.00

HDAC3 Rabbit mAb

A19537-200ul 200 ul
EUR 571.00

HDAC3 Rabbit mAb

A19537-20ul 20 ul
EUR 221.00

HDAC3 Rabbit mAb

A19537-50ul 50 ul
EUR 287.00

HDAC3 Rabbit pAb

A2139-100ul 100 ul
EUR 308.00

HDAC3 Rabbit pAb

A2139-200ul 200 ul
EUR 459.00

HDAC3 Rabbit pAb

A2139-20ul 20 ul
EUR 183.00

HDAC3 Rabbit pAb

A2139-50ul 50 ul
EUR 223.00

HDAC3 Mouse mAb

A2603-100ul 100 ul
EUR 384.00

HDAC3 Mouse mAb

A2603-200ul 200 ul
EUR 554.00

HDAC3 Mouse mAb

A2603-20ul 20 ul Ask for price

HDAC3 Mouse mAb

A2603-50ul 50 ul
EUR 265.00

Anti-HDAC3 Antibody

A00839 100ug/vial
EUR 294.00

HDAC3 Polyclonal Antibody

E-AB-31645-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Responsible for the deacetylation of lysine residues on the N-terminal part of the core hist
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat HDAC3 for WB,IHC-p,IF,ELISA applications.

HDAC3 Polyclonal Antibody

E-AB-31645-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Responsible for the deacetylation of lysine residues on the N-terminal part of the core hist
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat HDAC3 for WB,IHC-p,IF,ELISA applications.

HDAC3 Polyclonal Antibody

E-AB-31645-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Responsible for the deacetylation of lysine residues on the N-terminal part of the core hist
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat HDAC3 for WB,IHC-p,IF,ELISA applications.

HDAC3 Polyclonal Antibody

ES2500-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

HDAC3 Polyclonal Antibody

ES2500-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti-HDAC3 (3E11)

LF-MA10133 100 ug
EUR 363.00
Description: Mouse monoclonal to HDAC3

anti-HDAC3 (7G6C5)

LF-MA30212 100 ul
EUR 537.00
Description: Mouse Monoclonal to HDAC3

anti-HDAC3 (3A7B5)

LF-MA30213 100 ul
EUR 537.00
Description: Mouse Monoclonal to HDAC3

anti- HDAC3 antibody

FNab03798 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:50 - 1:200
  • IP: 1:50 - 1:200
  • ChIP: 1:20 - 1:100
  • Immunogen: histone deacetylase 3
  • Uniprot ID: O15379
  • Gene ID: 8841
  • Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against HDAC3

Anti-HDAC3 Antibody

PA1600 100ug/vial
EUR 334.00

Anti-HDAC3 Antibody

PA1600-1 100ug/vial
EUR 334.00

Anti-HDAC3 antibody

PAab03798 100 ug
EUR 355.00

pENTR223-HDAC3 vector

PVT12125 2 ug
EUR 308.00

Anti-HDAC3 antibody

STJ98129 100 µl
EUR 234.00
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ98130 100 µl
EUR 234.00
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ98496 100 µl
EUR 234.00
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ99157 200 µl
EUR 197.00
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ93479 200 µl
EUR 197.00
Description: Rabbit polyclonal to HDAC3.

Anti-HDAC3 antibody

STJ23930 100 µl
EUR 277.00
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody

STJ118902 100 µl
EUR 277.00

Anti-HDAC3 antibody

STJ29889 100 µl
EUR 393.00
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody

STJ73163 100 µg
EUR 359.00

Anti-HDAC3 antibody

STJ114416 100 µl
EUR 277.00
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 (2A3)

YF-MA16552 100 ug
EUR 363.00
Description: Mouse monoclonal to HDAC3

HDAC3 Conjugated Monoclonal Antibody

C27125 100ul
EUR 397.00

Phospho-HDAC3 (Ser424) Antibody

AF3016 200ul
EUR 304.00
Description: Phospho-HDAC3 (Ser424) Antibody detects endogenous levels of HDAC3 only when phosphorylated at Serine 424.

Rat HDAC3 shRNA Plasmid

20-abx986973
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-HDAC3 (S424) Antibody

1-CSB-PA010572
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-HDAC3 (S424). Recognizes Phospho-HDAC3 (S424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

HDAC3 Antibody, HRP conjugated

1-CSB-PA010239LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HDAC3 Antibody, FITC conjugated

1-CSB-PA010239LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HDAC3 Antibody, Biotin conjugated

1-CSB-PA010239LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-HDAC3 (Ser424) Antibody

CSB-PA170084-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-HDAC3 (Ser424). Recognizes Phospho-HDAC3 (Ser424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-HDAC3 (Ser424) Antibody

CSB-PA170084-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-HDAC3 (Ser424). Recognizes Phospho-HDAC3 (Ser424) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 (Phospho-Ser424) Antibody

12045-100ul 100ul
EUR 252.00

HDAC3 (Phospho-Ser424) Antibody

12045-50ul 50ul
EUR 187.00

HDAC3 recombinant monoclonal antibody

A5645 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human HDAC3 for WB ,ELISA

HDAC3 Cell ELISA Kit

abx595276-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.

Human HDAC3 shRNA Plasmid

20-abx955837
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho- HDAC3 (Ser424) Antibody

ABF3016 100 ug
EUR 438.00

HDAC3 Monoclonal Antibody [A10B1]

A-4003 100 µl
EUR 616.95
Description: The best epigenetics products

anti- HDAC3-specific antibody

FNab03799 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: histone deacetylase 3
  • Uniprot ID: O15379
  • Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against HDAC3-specific

Anti-HDAC3-specific antibody

PAab03799 100 ug
EUR 386.00

HDAC3 Recombinant Protein (Human)

RP014497 100 ug Ask for price

pECMV-3-FLAG-HDAC3

PVT12645 2 ug
EUR 703.00

HDAC3 Recombinant Protein (Rat)

RP204341 100 ug Ask for price

HDAC3 Recombinant Protein (Mouse)

RP141104 100 ug Ask for price

Anti-HDAC3 (2F9-4B7)

YF-MA16550 100 ug
EUR 363.00
Description: Mouse monoclonal to HDAC3

In an automated fashion, single worms were synchronized, isolated, and cultured from egg to adulthood in a microfluidic device, where their identity was preserved during their whole development. Several phenotypes were monitored and quantified for each animal, resulting in high-content phenome data. 

Share