Microfluidics-enabled phenotyping of a whole population of C. elegans worms over their embryonic and post-embryonic development at single-organism resolution.

The organism Caenorhabditis elegans is a performant model system for studying human biological processes and diseases, but until now all phenome data are produced as population-averaged read-outs.

Monitoring of individual responses to drug treatments would however be more informative. Here, a new strategy to track different phenotypic traits of individual C. elegans nematodes throughout their full life-cycle-i.e., embryonic and post-embryonic development, until adulthood onset, differently from life-span-is presented.

Human Histone Deacetylase 3 (HDAC3) ELISA kit
RDR-HDAC3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Histone Deacetylase 3 (HDAC3) ELISA kit
RDR-HDAC3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Hdac3/ Rat Hdac3 ELISA Kit
ELI-27737r	Lifescience Market	96 Tests	EUR 886

HDAC3 antibody
20R-2774	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody
21660-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
21660-50ul	SAB	50ul	EUR 187

HDAC3 Antibody
31216-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
31216-50ul	SAB	50ul	EUR 187

HDAC3 antibody
70R-17706	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody
70R-11943	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody
70R-31225	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody
6603-100	Biovision		EUR 338

HDAC3 Antibody
6603-30T	Biovision		EUR 146

HDAC3 antibody
70R-14137	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody
33400-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
33400-50ul	SAB	50ul	EUR 187

HDAC3 Antibody
3603-100	Biovision		EUR 316

HDAC3 Antibody
3603-30T	Biovision		EUR 146

HDAC3 Antibody
32620-100ul	SAB	100ul	EUR 252

HDAC3 antibody
10R-2003	Fitzgerald	100 ul	EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody
10R-2004	Fitzgerald	100 ul	EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody
10R-10389	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 Antibody
48964-100ul	SAB	100ul	EUR 333

HDAC3 Antibody
48964-50ul	SAB	50ul	EUR 239

HDAC3 Antibody
1-CSB-PA002880	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

HDAC3 Antibody
1-CSB-PA004117	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HDAC3 Antibody
CSB-PA916163-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody
CSB-PA916163-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody
CSB-PA967736-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody
CSB-PA967736-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody
1-CSB-PA899967	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

HDAC3 Antibody
DF6862	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

Hdac3 antibody
70R-8546	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Hdac3 antibody

HDAC3 antibody
70R-33611	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Protein
E24006	EpiGentek	50 µg	EUR 806.9
Description: fast delivery possible

HDAC3 Antibody
AF0733	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of HDAC3.

HDAC3 Antibody
AF5349	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
AF6016	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
BF0230	Affbiotech	200ul	EUR 376
Description: HDAC3 antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
1-CSB-PA010239GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HDAC3 Antibody
1-CSB-PA010239LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HDAC3 siRNA
20-abx919179	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HDAC3 siRNA
20-abx919180	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HDAC3 Antibody
ABF5349	Lifescience Market	100 ug	EUR 438

HDAC3 Antibody
ABF6016	Lifescience Market	100 ug	EUR 438

HDAC3 Antibody
ABD6862	Lifescience Market	100 ug	EUR 438

HDAC3 Antibody
ABF0733	Lifescience Market	100 ug	EUR 438

pOTB7-HDAC3
PVT18724	Lifescience Market	2 ug	EUR 231

anti-HDAC3
YF-PA15910	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to HDAC3

anti-HDAC3
YF-PA15911	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to HDAC3

anti-HDAC3
YF-PA15912	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to HDAC3

anti-HDAC3
YF-PA25204	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to HDAC3

anti-HDAC3
YF-PA25205	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to HDAC3

HDAC3 Monoclonal Antibody
27125-100ul	SAB	100ul	EUR 252

HDAC3 Monoclonal Antibody
27125-50ul	SAB	50ul	EUR 187

HDAC3 Rabbit pAb
A12542-100ul	Abclonal	100 ul	EUR 308

HDAC3 Rabbit pAb
A12542-200ul	Abclonal	200 ul	EUR 459

HDAC3 Rabbit pAb
A12542-20ul	Abclonal	20 ul	EUR 183

HDAC3 Rabbit pAb
A12542-50ul	Abclonal	50 ul	EUR 223

Hdac3 Blocking Peptide
33R-2222	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hdac3 antibody, catalog no. 70R-8546

HDAC3 Blocking Peptide
33R-10828	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HDAC3 antibody, catalog no. 70R-11943

HDAC3 Polyclonal Antibody
40996-100ul	SAB	100ul	EUR 252

HDAC3 Polyclonal Antibody
40996-50ul	SAB	50ul	EUR 187

HDAC3 Assay Kit
55R-1377	Fitzgerald	100 assays	EUR 693
Description: Assay Kit for detection of HDAC3 in the research laboratory

HDAC3 Blocking Peptide
DF6862-BP	Affbiotech	1mg	EUR 195

Anti-HDAC3 Antibody
A00839	BosterBio	100ug/vial	EUR 294

HDAC3 antibody (Ser424)
70R-33610	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HDAC3 antibody (Ser424)

HDAC3 (pS424) Antibody
abx010928-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

HDAC3 Blocking Peptide
AF0733-BP	Affbiotech	1mg	EUR 195

HDAC3 Blocking Peptide
AF5349-BP	Affbiotech	1mg	EUR 195

HDAC3 Blocking Peptide
AF6016-BP	Affbiotech	1mg	EUR 195

HDAC3 Conjugated Antibody
C32620	SAB	100ul	EUR 397

HDAC3 Conjugated Antibody
C31216	SAB	100ul	EUR 397

HDAC3 Blocking Peptide
BF0230-BP	Affbiotech	1mg	EUR 195

HDAC3-specific Antibody
abx233799-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

HDAC3 (pS424) Antibody
abx333379-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Polyclonal HDAC3 Antibody
AMM05315G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Polyclonal HDAC3 Antibody
AMM05316G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Monoclonal HDAC3 Antibody
AMM05317G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human HDAC3. The antibodies are raised in Mouse. This antibody is applicable in WB

HDAC3 cloning plasmid
CSB-CL010239HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1287 Sequence: atggccaagaccgtggcctatttctacgaccccgacgtgggcaacttccactacggagctggacaccctatgaagccccatcgcctggcattgacccatagcctggtcctgcattacggtctctataagaagatgatcgtcttcaagccataccaggcctcccagcatgacatgt Show more
Description: A cloning plasmid for the HDAC3 gene.

HDAC3 Polyclonal Antibody
ABP51501-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424 Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody
ABP51501-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424 Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody
ABP51501-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424 Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody
A68305	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

HDAC3 Rabbit mAb
A19537-100ul	Abclonal	100 ul	EUR 410

HDAC3 Rabbit mAb
A19537-200ul	Abclonal	200 ul	EUR 571

HDAC3 Rabbit mAb
A19537-20ul	Abclonal	20 ul	EUR 221

HDAC3 Rabbit mAb
A19537-50ul	Abclonal	50 ul	EUR 287

HDAC3 Rabbit pAb
A2139-100ul	Abclonal	100 ul	EUR 308

HDAC3 Rabbit pAb
A2139-200ul	Abclonal	200 ul	EUR 459

HDAC3 Rabbit pAb
A2139-20ul	Abclonal	20 ul	EUR 183

HDAC3 Rabbit pAb
A2139-50ul	Abclonal	50 ul	EUR 223

HDAC3 Mouse mAb
A2603-100ul	Abclonal	100 ul	EUR 384

HDAC3 Mouse mAb
A2603-200ul	Abclonal	200 ul	EUR 554

HDAC3 Mouse mAb
A2603-20ul	Abclonal	20 ul	Ask for price

HDAC3 Mouse mAb
A2603-50ul	Abclonal	50 ul	EUR 265

HDAC3 Rabbit pAb
A16462-100ul	Abclonal	100 ul	EUR 308

HDAC3 Rabbit pAb
A16462-200ul	Abclonal	200 ul	EUR 459

In an automated fashion, single worms were synchronized, isolated, and cultured from egg to adulthood in a microfluidic device, where their identity was preserved during their whole development. Several phenotypes were monitored and quantified for each animal, resulting in high-content phenome data.